Department of Veterans Affairs, Acquisition Opeations Service (93A), 810 Vermont Avenue, NW, Washington, DC 20420

A -- RESEARCH & DEVELOPMENT SOL RFP 101-16-99 DUE 071399 POC Tyrone Lassiter, Contracting Officer (202) 273-8771 E-MAIL: Click here to contact the Contracting Officer with, tyrone.lassiter@mail.va.gov. Request for Proposal 101-16-99 is a combined synopsis/solicitation for commercial items for the Department of Veterans Affairs Office of Research and Development, Veterans Health Administration, Washington, DC, (VA) prepared in accordance with the format in FAR Subpart 12.6, as supplemented by additional information included in this notice and provisions and clauses through FAC 97-11. SIC 8071 applies. This announcement constitutes the only solicitation; proposals are being requested -- a written solicitation will NOT be issued. VA seeks two (2) laboratories to perform the following Schedule of Services -- LABORATORY MYCOPLASMA DETERMINATION PROTOCOL -- I. BLOOD SAMPLE COLLECTION: Thirty (30) participating medical centers will be collecting patient whole blood specimens (three 4-cc vials/patient) in purple-top EDTA tubes, mixed, quickly cooled with wet ice and frozen within one hour. These frozen samples will be either sent by overnight delivery with dry ice to the Central Laboratory, Department of Microbiology UT Health Sciences Center 7703 Floyd Curl Drive San Antonio, TX 78284-7758, or are to be immediately stored at -80oC until a satisfactory number of individual patient specimens are obtained and then mailed overnight with dry ice. Blood specimens will be coded by location and patient identification number. All blood samples will be sent to you from the Central Laboratory. (2 of 3 samples will be kept at -80 C for random distribution to 2 testing laboratories for quality control assurances, or for long-term storage. The Central Laboratory and testing laboratories will process specific patient blood specimens using the Chelex procedure described below for PCR assays. Once the Chelex procedure is completed, PCR testing can be performed immediately, or the chelex-treated specimens can be frozen at -80oC for PCR-testing later. The remaining portion of each blood sample used in the Chelex procedure will be immediately frozen and stored should additional testing of an individual specimen be required due to technical problems. Also, the Central Laboratory will provide individual blood samples for determination of doxycycline levels by a pharmacology testing laboratory. Each sample will require four tests, Genus-specific 16S rRNA, M. fermentans, M. genitalium and M. pneumoniae. It is estimated that the quality control assurance laboratory will receive an estimated 720 samples over a 30 month period with the largest number of samples being tested in the first 18 months. This estimate of 720 samples is based on 20% of the initial patient blood samples testing positive for mycoplasma species. If the percent positive samples are greater than 20%, then the number of samples to be tested will be reduced accordingly. This is "PER SAMPLE" contract and offerors shall provide a unit price per "TEST SAMPLE". The estimated number of samples to be tested shall be no more than 10 % above or below the Government's Estimate of 720 samples. The Perry Point Coordinating Center will provide the contract laboratory with a "Laboratory Log Sheet Form" which shall be completed by the contract laboratory for each sample. When the tests have been performed and results achieved, the contractor is to complete the Laboratory Log Sheet form and return the original to the Perry Point Coordinating Center. Payment will be issued for all tests completed as shown on the Laboratory Log Sheet Form received at Perry Point.. Estimated start date of this contract is August 1, 1999. II. CHELEX PROCEDURE-FORENSIC DNA PREPARATION (DNA PURIFICATION AND PREPARATION FROM WHOLE BLOOD): [1] Add 50 ml of whole blood to 1 ml of autoclaved nanopure water in an autoclaved 1.5 ml microcentrifuge tube. Mix by inverting several times. Incubate 20 min on a platform mixer. [2] Centrifuge at 12,000 x g for 2 min in microfuge at room temperature. [3] Carefully remove all supernatant by aspiration with an aerosol barrier tip. [4] Add 1 ml of autoclaved nanopure water to pellet, mix gently, let stand for 20 min, and then centrifuge at 12,000 x g for 2 min as above. [5] Carefully remove all but 20-30 ml of supernatant with a barrier pipette tip. Do not disturb pellet. [6] Add 200 ml of Chelex (Bio-Rad Catalogue #732-6030) to pellet and incubate at 56oC for 20 min. (Chelex should be placed on magnetic stirrer at moderate speed while obtaining 200 ml aliquot in order to maintain suspension). [7] Vortex at high speed for 10 sec, and then place tube in boiling water bath or 100 C heat block for 10 min. [8] Vortex at high speed for 10 sec, and then centrifuge at 12,000 x g for 2 min as above. [9] Use supernatant to set up PCR procedures. Freeze remaining sample for future use. III. MYCOPLASMA SPECIES PCR (FOR USE WITH SPECIFIC PRIMERS FOR M. FERMENTANS, M. GENITALIUM, AND M. PNEUMONIAE.) (A) Preparation of PCR master mix (for 20 reactions): [1] Add 100 ml of Perkin Elmer Amplitaq buffer containing MgCl. [2] Add 80 ml of mixed Perkin Elmer dNTPs (0.2mM each). [3] Add 20 ml Triton X-100 (1:20 dil in H2O). [4] Add 10 ml of each primer (equal amounts of forward and reverse primers; 100 pmoles/ml each). [5] Add 10 ml H2O. [6] Add 10 ml AmpliTaq Gold enzyme (Perkin-Elmer, Catalogue # N808-0240). (B) PCR SET-UP: [1] For each sample add 12 ml master mix and 38 ml Chelex-prepared DNA. [2] Set up positive and negative controls. Negative controls contain 12 ml master mix and 38 ml H2O. Positive controls contain 12 ml master mix and 37 ml H2O (then add 1 ml of appropriate DNA concentration in separate lab). Run 1fg, 1pg and 1 ng amounts of positive control DNA. [3] Mix samples by inversion and briefly centrifuge to bring all contents to bottom of tube. [4] Place in thermocycler and run Gulf War Program. (C) GULF WAR PROGRAM FOR THERMOCYCLER FOR USE WITH ALL PRIMER SETS: [1] Hold samples 12 min at 95oC.[2] Denature at 95oC for 1 min. [3] Anneal at 60oC for 1 min. [4] Extend at 72oC for 1 min. [5] Return to step 2 for 39 times. [6] Hold at 72oC for 10 min. [7] Hold at 4oC until ready to run gel. At this point samples can also be frozen for later use. IV. ANALYSIS OF PCR PRODUCT: (A) Electrophoresis [1] Prepare1% agarose gel with 1X TAE buffer. [2] Run 18 ml of PCR product with 2 ml 10X loading buffer for each sample. [3] Photograph gel and transfer to nylon membrane.(B) Gel transfer to nylon membrane. [1] Denature gel in 100 ml of 0.5 M NaOH and incubate by rocking 45 min. [2] Neutralize gel in 100 ml of 1 M Tris-HCl (pH 8) and incubate by rocking for 45 minutes. [3] Transfer gel to 400 ml of 10X SSC in a tray, with a glass plate above it with two ends of blotter paper (wet with 10X SSC) extending on either side of the glass tray. Lay gel facedown on blotter paper and smooth out bubbles. Lay piece of Nytran membrane previously wetted with water on top of the gel and again smooth out bubbles. Place a stack of absorbent paper on top of Nytran membrane, then place a weight on top and leave overnight. (C) Hybridization [1] Prehybridize membrane at 50oC overnight in 6X SSC, 0.2% SDS, 5X Denhardt's solution and 100mg/ml denatured salmon sperm DNA. [2] Hybridize for 3 days (typically, overnight should be sufficient) at 50oC in 5X SSC, 0.2% SDS, 5X Denhardt's solution, 100 mg/ml denatured salmon sperm DNA, and 106 CPM of freshly labeled oligo probe. (D) Oligonucleotide 5 -end labeling [1] Add 38 ml H20 to a microcentrifuge tube.[2] Add 5 ml 10X One-Phor-All Buffer. [3] Add 1 ml oligo (50pmoles/ml solution). [4] Add 1 ml T4 kinase (8-10 units, Pharmacia Catalogue # E70031Y). [5] Add 5 ml gamma-32P ATP. [6] Incubate 1 hour at 37oC. [7] Use spin column (Boehringer Mannheim Catalogue # 1 522 981) to purify by centrifugation at 1,100 x g for 2 min in clinical centrifuge. [8] Discard collected liquid, add probe to top of column, centrifuge at 1,100 x g for 4 min, and collect purified probe in collection tube. (E) Washing filter after hybridization [1] Discard hybridization solution and wash with 100 ml (6X SSC, 0.1% SDS) for 3 min. [2] For the next wash use 100 ml (2X SSC, 0.1% SDS) at 42oC for 20 min. [3] Repeat the last washing step. [4] Remove membrane and dry. [5] Expose to X-ray film for 8 days at -80oC. [6] Develop film and evaluate results. V. MYCOPLASMA GENUS SPECIFIC 16S PCR* {1} Prepare master mix for number of samples and controls to be run as determined by the following amounts per test sample or control. [5 ml Gibco PCR buffer] [1.75 ml 10mM dNTP's] [2ml 50mM MgCl] [0.5 ml Taq (Gibco Catalogue # 18038-042)] [0.25 ml GP01 primer (100pmoles/ml)] [0.25 ml MGSO primer (100pmoles/ml)] [0.25 ml H2O] <*This assay may be replaced by PCR using Perkin-Elmer AmpliTaq Gold system described above under Section III; preliminary assays are being performed to determine comparative detection sensitivities.> {2} Add 10 ml master mix and 40 ml Chelex sample for each sample. Add 10 ml master mix and 40 ml H2O for negative control. Add 10 ml of master mix, 39 ml of H2O, and 1ml of appropriate concentration of positive control DNA. {3} Place in thermocycler and run program described above in PCR procedure. {4} Remove samples when program is completed. {5} Follow steps to analyze PCR products described above under section IV. VI. PCR PRECAUTIONS AGAINST CONTAMINATION -- {1} Set up Chelex procedure, PCR, and PCR analysis in separate rooms. {2}All tubes and reagents should be prepared in an area outside of laboratory where mycoplasma work is performed. {3}Change gloves often, especially between Chelex procedure, PCR, and PCR analysis. {4}Use separate aerosol barrier tips for each addition of reagent, until PCR has been completed. Do not pipette up and down. Mix by inversion or stirring with the barrier tip. {5} Before setting up PCR in PCR room, turn on UV light 3-4 hours earlier. {6} Before setting up PCR in PCR room, wipe bench area with 1M HCl to destroy contaminating DNA that might be present. {7}Add all positive controls in separate room from PCR room. VII. PRIMER SETS & PROBES FOR GULF WAR PCR: [16 S primers and probe {GPO1-primer ACTCCTACGGGAGGCAGCAGTA}{MGSO primer TGCACCATCTGTCACTCTGTTAACCTC}{Uni-probe TAATCCTGTTTGCTCCCCAC} Expected product size 710 bp] [M. fermentens insertion sequence primers and probe {RW004 primer GGACTATTGTCTAAACAATTTCCC}{RW005 primer GGTTATTCGATTTCTAAATCGCCT}{RW006 probe GCTGTGGCCATTCTCTTCTACGTT} Expected product size 205 bp] [M. genitalium primers and probe {MgPa-1 primer AGTTGATGAAACCTTAACCCCTTGG}{ MgPa-2 primer CCGTTGAGGGGTTTTCCATTTTTGC}{MgPa-3 probe GACCATCAAGGTATTTCTCAACAGC}Expected product size 280 bp] [M. pneumoniae primers and probe {MP5-1 primer GAAGCTTATGGTACAGGTTGG}{MP5-2 primer ATTACCATCCTTGTTGTAAGG}{MP5-3 probe CGTAAGCTATCAGCTACATGGAGG} Expected product size 144 bp] The Contractor agrees to comply with the following incorporated provisions and clauses in effect through FAC 97-11 and are applicable to this solicitation: 52.212-1 Instruction to Offerors -- Commercial Items; 52.212-2 Evaluation -- Commercial Items; 52.212-3 Offeror Representations and Certifications-Commercial Items (to be completed and included with offer); 52.212-4 Contract Terms and Conditions-Commercial Items; 52.212-5-Contract Terms and Conditions Required to Implement Statutes on Executive Orders-Commercial Items and Y2K Warranty Clause. All responsible sources submitting cost and technical proposals on their company letterhead or bid form. Technical capabilities of the contractor will be considered equal to price proposals to determine "best value" for the Government. Technical proposals must furnish detailed data and information concerning the technical capability of the contractor to perform the services. Technical Proposals will be evaluated both for minimum technical acceptability and for the purpose of determining quality differences between competing proposals. The following technical factors will be evaluated and are equal in weight. [1] Past Performance: Past performance will be evaluated in the following areas: timeliness; problem responsiveness; quality of services; technical capability, & cooperativeness. In order to be found acceptable the offeror must demonstrate an acceptable level of satisfaction in each of the stated areas. [2] Corporate Capability -- the following areas relate to corporate capability and are equal in importance. (a) Resources and revenue to deliver competent performance in an effective and economic manner; (b) Technical expertise [3] Management Plan -- offeror's shall submit information to demonstrate the soundness of its management approach. Soundness of approach means that which conforms to the requirements of the solicitation; is inherently logical, efficient, and effective; and poses minimal risk to the Government. EVALUATION OF PRICE PROPOSALS -- Price proposals will be evaluated both to determine price realism and price reasonableness, and to establish the total evaluated price for each offeror. Price realism will be evaluated to ensure that proposed unit prices for test to be performed, reflect an understanding of the work required for competent performance of the contract. Price proposals determined to be unrealistic in terms of technical commitment or unrealistically low in cost or price will be deemed reflective of an inherent lack of technical competenceor indicative of failure to comprehend the complexity and risk of the contract requirements and may be grounds for the rejection of the proposal. Price proposals will be evaluated to ensure that proposed unit prices are in concert both with industry standards for the relevant geographic areas and with prices in predecessor contracts, and are not excessive in comparison to such standards and contracts. The Government may award a contract based on initial offers received, without discussion of such offers. Accordingly, each initial offer should be submitted on the most favorable price and technical terms that the offeror can submit to the Government. Offerors shall identify all proposal packages by writing the solicitation number on each document. Proposals are due no later than 2:00 p.m. EST, 7/13/99, and shall be addressed to the CO listed in this ad. FAXED requests will be accepted at (202)273-7458. Posted 06/23/99 (W-SN346069). (0174)

Loren Data Corp. http://www.ld.com (SYN# 0011 19990625\A-0011.SOL)